NOTE:The same positive and negative controls can be used for both A.s. and L.b. Cas12a (Cpf1) nucleases.
To order, copy and paste the appropriate name and sequence from the following list into this ordering page:Cas12a (Cpf1) positive control crRNAs | |
---|---|
Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Human HPRT |
Sequence: | GGTTAAAGATGGTTAAATGAT |
Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Mouse HPRT |
Sequence: | GGATGTTAAGAGTCCCTATCT |
Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Rat HPRT |
Sequence: | ATGCTTAAGAGGTATTTGTTA |
Cas12a (Cpf1) negative control crRNAs | |
---|---|
Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #1 |
Sequence: | CGTTAATCGCGTATAATACGG |
Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #2 |
Sequence: | CATATTGCGCGTATAGTCGCG |
Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #3 |
Sequence: | GGCGCGTATAGTCGCGCGTAT |
The Alt-R CRISPR gRNA products (crRNA:tracrRNA and sgRNA) are now chemically modified for enhanced RNA stability. To read more about the latest performance improvements, visit the product page.
Enter the 20 base DNA sequence upstream of the PAM site, as shown, and you are ready to continue. The ordering tool will automatically convert the DNA sequence to RNA during the ordering process. If you are pasting your CRISPR target site from an online design tool, make sure you verify the correct strand orientation.
![]() |
Enter the 20–24 base DNA sequence 3′ of the target Cas12a (Cpf1) PAM site (TTTN), and you are ready to continue. The ordering tool will automatically convert the DNA sequence to RNA during the ordering process. If you are pasting your Cas12a (Cpf1) target site from an online design tool, make sure you verify the correct strand orientation.
![]() |
Enter your DNA sequence in the Sequence box and use the drop down menus to select your desired specifications. We provide three options for Alt-R HDR Donor Oligo modifications. Alt-R HDR modified is our recommended option for the best HDR performance and includes 2 phosphorothioate (PS) linkages and also an IDT proprietary end-blocking modification at each end to provide increased stability. Phosphorothioate modified will contain 2 PS linkages at each end of the DNA sequence and Unmodified will contain only standard DNA.