You will be logged off in  seconds due to inactivity. Click here to continue using this web page.
Get Help Sign In
ProcessingProcessing

CRISPR-Cas12a (Cpf1) crRNA Oligo Entry

Loading Page...

# of Items:
(5' → 3')
# Bases:
GC: %  Tm: ºC  DeltaG: kcal/mole

Include reverse complement
The following items have errors:
,

Looking for controls?

NOTE:The same positive and negative controls can be used for both A.s. and L.b. Cas12a (Cpf1) nucleases.

To order, increase the # of items, then copy and paste the appropriate name and sequence from the following list into this ordering page:
Cas12a (Cpf1) positive control crRNAs
Item Name: Cas12a (Cpf1) Pos Ctrl crRNA, Human HPRT
Sequence: GGTTAAAGATGGTTAAATGAT
Item Name: Cas12a (Cpf1) Pos Ctrl crRNA, Mouse HPRT
Sequence: GGATGTTAAGAGTCCCTATCT
Item Name: Cas12a (Cpf1) Pos Ctrl crRNA, Rat HPRT
Sequence: ATGCTTAAGAGGTATTTGTTA
Cas12a (Cpf1) negative control crRNAs
Item Name: Cas12a (Cpf1) Neg Ctrl crRNA #1
Sequence: CGTTAATCGCGTATAATACGG
Item Name: Cas12a (Cpf1) Neg Ctrl crRNA #2
Sequence: CATATTGCGCGTATAGTCGCG
Item Name: Cas12a (Cpf1) Neg Ctrl crRNA #3
Sequence: GGCGCGTATAGTCGCGCGTAT
 
 
Your Advocate for the Genomics Age