Our team has assembled a list of frequently asked questions to help you find answers quickly. Filter using one or more categories to focus on specific topics, or use the search bar to perform a text search.
Alt-R HDR Donor Blocks have additional sequence and chemical modifications to both ends of the ordered sequence that improve the on-target capabilities and integration efficiency relative to unmodified double stranded DNA. The exact nature of the modifications is an IDT proprietary technology that reduces or prevents the insertion of donor DNA via non homologous end joining (NHEJ). NHEJ is a nonspecific and error prone DNA cellular repair method. When unmodified double-stranded DNA is used as donors, this repair mechanism can lead to duplicated sequence errors at the targeted site as well as nonspecific integration elsewhere within the genome.
The modifications to IDT’s Alt-R HDR Donor Blocks occur in the 29 or 30 bases of sequence that are added to each end of the sequence ordered. While the modifications are proprietary, the sequences themselves are available upon request. These sequences have been confirmed to be absent from human and most other mammalian species and are not observed to integrate into the genomes via HDR.
It should also be noted that the universal ends will not be sequenced as these are not part of the customer's design, nor do they integrate into the genome during HDR.
Univ 5´ GTCGTACCGACTGGTAGATGACAGCAAACC
Univ 3´ GATCCGAAAACGGGCGTATAGTCGAGACC